Welcome to WormBase - need help?
Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

e-PCR Search

This search uses Greg Schuler's e-PCR program to search for STSs in the current C. elegans genome.

You may also consider alternative tools to e-PCR, such as UCSC In-Silico PCR and Primer-BLAST.

Enter a list of primer pairs to find using the following format:

Name     Left Oligo               Right Oligo              Length
assay_1  CGATAAACAATCAACGGCATAAT  TTTGAAACTGATATAGAGGGGCA  1188
assay_2  AAGGTTATTTATGCGGTGGAAAT  AGCACTTTGAGCTTGATGAAATC  2191
assay_3  AGATTGGAACGATAACGCAGATA  TTTGCCAATTTGCATTTTATTTT  1603

Alternatively, select List of assay names and enter a list of PCR product names already in WormBase to see what genes they intersect.

e-PCR Search
This is a
Allow product length difference of: bp   Allow oligo mismatches of: bp
Results in:

This may take several minutes to run. Hit the stop or back buttons to abort.